Scientists are Gods

faggot

lol

The world is awesome

they didnt create life. they used a cell that was already living and basically tweeked a few things

and this was already done 20 years ago

warm white creamy salvation

IMO I feel that you can believe in god, and believe in the big bang and evolution, in fact I believe in all of those things.  I dont take teh bible as a direct meaning, large portions of it are metaphors I think (although I do believe in jesus's story and the miracles he did)

Also, I follow what the existentalist philosopher Soren Kirkegaard said, which is along the lines of we cant know if god is there, quit trying to prove it, its called faith for a reason.

No they didn't.

They took 4 chemicals; Adenine, Thymine, Guanine and Cytosine, and combined them one base pair at a time to form a 100% man made genetic code. They didn't change certain parts of an existing genetic code, or even put an existing genetic code in a new cell.

THEY CREATED A GENETIC CODE BASED ON A COMPUTER SEQUENCING:

ATGCATCGTACTGACTGCATGATCGAGTCACCATATCGGAGAATCTAGCGGACTCTAGGAGCCAGGACTATCGACGAGCGA

That is what it looked like in a computer. That life form never existed before. The computer came up with the sequence based on our knowledge of the genome. The computer created life. The cell was an empty vessel to receive the genetic code. Given they did not make it "alive", in that they did not spark its "life" This discovery will be in the future. But they gave it the blueprint for life and it reproduced. Its mother was a computer, it is the first cell on earth to be born from a computer.

or destroy anything we want. (not that we can't already, but this could open up new realms in biological warfare) it will be truly interesting to see where this is at when we're all old.

true. I don't like dealing with the ethical shit, I am all for 100% science free range style. If we kill ourselves fuck it.

indeed, progress takes sacrifice, and dedication

yes, yes, YES!

I agree with you in that science should not be inhibited. We wouldn't be where we are today if it were, but the possible ethical implications can't be completely disregarded as we move forward with these breakthroughs. We may someday find ourselves in a position similar to that of the Cold War era, except on biological terms as opposed to nuclear. (Just the tip of the ethical ice burg) Hopefully at this stage in the game man has learned enough of a lesson so that more good than bad will come of this.

damn i bet its so easy for her to grab nose

I agree that ethics will play a major role in the future. Ethics is just a lot more complicated and harder than the science, so I dont want to deal with it.

I understand why ethics exist but they also can get in the way a ton too.

*cough cough* stem cell research *cough*

Exactly. I understand how they can help and you hear stories of how they help but it's just a weird ethical zone.

this is wild.. but i dont know how i feel about this.

this/threads

i agreed with most of what you said, but we still haven't figured out  how to synthesize a living cell and get it to reproduce sexually, much less live as a multicellular organism. We are sooooo far from having an instruction booklet for life. We haven't even discovered all the life on our planet. But i agree the possibilities are limitless, i would actually go as far as to say the possibilities are eternal.

For all of you tool's who think this is proof that god does't exist, please go and prove to me HOW gravity works or prove what space is made out of. You can't prove shit. Our knowlegde only consists of our understanding of known facts, which is very little.

I don't beleive life is "magical" but i find life to be the most beautiful existance in the known universe. as far as "god(s)" is(are) concered, he(they) is(are) a(-) scientist(s). slowly we figure out how he(they) might have done things.

Pretty sure the synthetic cell can reproduce.

If you look at any technological revolution there is always an initial discovery that breaks ground then there is an exponential trend. So things that seam far away now are likely to be much, much closer. And when I said instruction book I was referring to genetic code, not life. Even the human genetic code has been sequenced (by the same scientist that made this discovery). So we have the instruction book, just not all the tools we need to build (yet).

I work on fact, I have never seen any factual evidence for god. Just because something can't be explained does not mean god did it. The burden of proof is not on a scientist or an Atheist to disprove god. The burden of proof is on religious people, for that reason I will never get into an argument with a religious person about their religion because every one of their "facts" comes from books written 2000 years ago with no scientific basis, and proven historical and scientific inaccurate (as well as moral contradictions, how can you pick and choose what parts of the bible you want to believe? Blows my mind.). I really don't see how people can be religious if you take a couple hours and look back on the history of religion. Being religious or having a belief in god serves 2 purposes. 1) to make you feel like death is less final so you can function. 2) To explain the world and events and make you feel less small.

I guess I should separate religion and a belief in god. If you subscribe to an organized religion I have no problem with that, but don't ever try and tell me anything you believe is fact. If you believe in god but pick and choose what scientific facts to subscribe to to meet your religious needs then you are a fool.

asexually yes, but that is nothing better than what lichens achieved a few million years ago.

reproducing sexually is a completely different story.

look this up it will blow your mind "alternation of generations"

true, although I am not sure if it is sexually or cell splitting (Meiosis?) I am not sure what the difference genetically is but I would assume for practical applications you don't really want to create a sexual cell that would undo your work.

i completely agree with you, i am just saying that i am not ruling out the possibility. i am not commenting on the legitimacy of religious text.

i enjoy fantasizing about the unknown. thus the mumbo jumbo in my last paragraph.